Background Urinary Tract An infection (UTI) is among the most typical infections encountered in medical follow. Proof helps that empirical therapy tips based mostly on native bacterial spectrum and antimicrobial resistance (AMR) surveillance present the perfect medical outcomes and in addition stop the emergence of resistant strains. Antimicrobial resistance has been growing at an alarming charge all through the world. This warrants steady reporting and surveillance of the emergence of AMR among the many uropathogens throughout areas and nations. Supplies and strategies A retrospective cross-sectional examine utilizing antibiograms of grownup sufferers with culture-proven UTI throughout January 2011 and January 2017 was executed.
Comparative evaluation was carried out between the 2 examine durations for the prevalence, altering tendencies of antimicrobial resistance, and utilization of antimicrobials for testing. Outcomes The most typical organism cultured throughout every examine interval was Escherichia coli (56.6% and 51.6%). Essentially the most ceaselessly examined antibiotics have been ampicillin (97%, 88%), amikacin (85%, 85%), nitrofurantoin (95%, 95%), cephalexin (84%, 93%), and norfloxacin (83%, 83%). There was a major improve in resistance proportion famous for imipenem (by 29.8%), meropenem (by 18.3%), ertapenem (by 24.9%), ciprofloxacin (by 26.5%), nitrofurantoin (by 11.2%), amikacin (by 8.7%), and cefotaxime (by 7.4%) in 2017 as in comparison with 2011.
A major improve in susceptibility was seen for tobramycin (by 32.5%), cefepime (by 14.4%), and polymyxin (by 12.6%) in 2017 when in comparison with 2011. Conclusion Our evaluation has proven that there’s an alarmingly growing development for AMR amongst uropathogens on this area as in comparison with developed nations. Knowledge on altering tendencies of antimicrobial testing and reporting would possibly assist in strengthening antimicrobial surveillance.
The Barley HvWRKY6 Transcription Issue Is Required for Resistance In opposition to Pyrenophora teres f. teres
Barley is a crucial cereal crop worldwide due to its use within the brewing and distilling trade. Nonetheless, ample provides of high quality malting barley are threatened by international local weather change because of drought in some areas and extra precipitation in others, which facilitates epidemics brought on by fungal pathogens. The illness web type web blotch brought on by the necrotrophic fungal pathogen Pyrenophora teres f. teres (Ptt) has emerged as a worldwide risk to barley manufacturing and numerous populations of Ptt have proven a capability to beat deployed genetic resistances. The barley line CI5791 displays remarkably efficient resistance to numerous Ptt isolates from all over the world that maps to 2 main QTL on chromosomes 3H and 6H.
To determine genes concerned on this efficient resistance, CI5791 seed have been γ-irradiated and two mutants, designated CI5791-γ3 and CI5791-γ8, with compromised Ptt resistance have been recognized from an M2 inhabitants. Phenotyping of CI5791-γ3 and -γ8 × Heartland F2 populations confirmed three resistant to at least one inclined segregation ratios and CI5791-γ3 × -γ8 F1 people have been inclined, thus these unbiased mutants are in a single allelic gene. Thirty-four homozygous mutant (inclined) CI5791-γ3 × Heartland F2 people, representing 68 recombinant gametes, have been genotyped through PCR genotype by sequencing.
The information have been used for single marker regression mapping putting the mutation on chromosome 3H inside an approximate 75 cM interval encompassing the 3H CI5791 resistance QTL. Sequencing of the mutants and wild-type (WT) CI5791 genomic DNA following exome seize recognized unbiased mutations of the HvWRKY6 transcription issue positioned on chromosome 3H at ∼50.7 cM, throughout the genetically delimited area. Put up transcriptional gene silencing of HvWRKY6 in barley line CI5791 resulted in Ptt susceptibility, confirming that it features in NFNB resistance, validating it because the gene underlying the mutant phenotypes.

Allele evaluation and transcript regulation of HvWRKY6 from resistant and inclined strains revealed sequence id and upregulation upon pathogen problem in all genotypes analyzed, suggesting a conserved transcription issue is concerned within the protection towards the necrotrophic pathogen. We hypothesize that HvWRKY6 features as a conserved signaling part of protection mechanisms that restricts Ptt development in barley.
Metagenomics-Based mostly Strategy to Supply-Attribution of Antimicrobial Resistance Determinants – Identification of Reservoir Resistome Signatures
Metagenomics can unveil the genetic content material of the overall microbiota in several environments, similar to meals merchandise and the heart of people and livestock. It’s subsequently thought-about of nice potential to analyze the transmission of foodborne hazards as a part of source-attribution research. Supply-attribution of antimicrobial resistance (AMR) has historically relied on pathogen isolation, whereas metagenomics permits investigating the total span of AMR determinants.
On this examine, we hypothesized that the relative abundance of fecal resistome elements might be related to particular reservoirs, and that resistomes can be utilized for AMR source-attribution. We used shotgun-sequences from fecal samples of pigs, broilers, turkeys- and veal calves collected throughout Europe, and fecal samples from people occupationally uncovered to livestock in a single nation (pig slaughterhouse employees, pig and broiler farmers). We utilized each hierarchical and flat types of the supervised classification ensemble algorithm Random Forests to categorise resistomes into corresponding reservoir courses.
We recognized country-specific and -independent AMR determinants, and assessed the impression of country-specific determinants when attributing AMR resistance in people. Moreover, we carried out a similarity proportion evaluation with the total spectrum of AMR determinants to determine resistome signatures for the totally different reservoirs. We confirmed that the variety of AMR determinants essential to attribute a resistome into the proper reservoir will increase with a bigger reservoir heterogeneity, and that the impression of country-specific resistome signatures on prediction varies between nations. We predicted the next occupational publicity to AMR determinants amongst employees uncovered to pigs than amongst these uncovered to broilers. Moreover, outcomes advised that AMR publicity on pig farms was larger than in pig slaughterhouses.
Human resistomes have been extra just like pig and veal calves’ resistomes than to these of broilers and turkeys, and the vast majority of these resistome dissimilarities might be defined by a small set of AMR determinants. We recognized resistome signatures for every particular person reservoir, which embrace AMR determinants considerably related to on-farm antimicrobial use.
Human Myxovirus Resistance 1 (MX1) ELISA Kit |
RDR-MX1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 589 |
Human Myxovirus Resistance 1 (MX1) ELISA Kit |
RDR-MX1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 820 |
MX1 Antibody |
36545-100ul |
SAB |
100ul |
EUR 252 |
MX1 antibody |
38296-100ul |
SAB |
100ul |
EUR 252 |
MX1 antibody |
22124-100ul |
SAB |
100ul |
EUR 390 |
MX1 antibody |
22613-100ul |
SAB |
100ul |
EUR 390 |
MX1 antibody |
10R-4913 |
Fitzgerald |
100 ul |
EUR 726 |
Description: Mouse monoclonal MX1 antibody |
MX1 antibody |
70R-18688 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal MX1 antibody |
MX1 antibody |
70R-13354 |
Fitzgerald |
100 ul |
EUR 457 |
Description: Affinity purified Rabbit polyclonal MX1 antibody |
MX1 antibody |
70R-13404 |
Fitzgerald |
100 ul |
EUR 457 |
Description: Affinity purified Rabbit polyclonal MX1 antibody |
MX1 Antibody |
DF6612 |
Affbiotech |
200ul |
EUR 304 |
Description: MX1 Antibody detects endogenous levels of total MX1. |
MX1 Antibody |
1-CSB-PA616832 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against MX1. Recognizes MX1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000 |
MX1 Antibody |
1-CSB-PA015249GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against MX1. Recognizes MX1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
MX1 Antibody |
1-CSB-PA015249LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against MX1. Recognizes MX1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF, IP; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IF:1:50-1:200, IP:1:200-1:2000 |
MX1 Conjugated Antibody |
C36545 |
SAB |
100ul |
EUR 397 |
MX1 Conjugated Antibody |
C38296 |
SAB |
100ul |
EUR 397 |
anti- MX1 antibody |
FNab09996 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500-1:2000
- IHC: 1:20-1:200
- Immunogen: Myxovirus resistance protein 1
- Uniprot ID: P20591
- Gene ID: 4599
- Research Area: Immunology, Signal Transduction
|
Description: Antibody raised against MX1 |
anti- MX1 antibody |
FNab05450 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500-1:1000
- IP: 1:500-1:1000
- IHC: 1:20-1:200
- IF: 1:20-1:200
- Immunogen: Myxovirus resistance protein 1
- Uniprot ID: P20591
- Gene ID: 4599
- Research Area: Immunology, Signal Transduction
|
Description: Antibody raised against MX1 |
MX1 Polyclonal Antibody |
ES9210-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MX1 from Human/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
MX1 Polyclonal Antibody |
ES9210-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MX1 from Human/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
MX1 Polyclonal Antibody |
ABP59348-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human MX1 protein at amino acid sequence of 500-580
- Applications tips:
|
Description: A polyclonal antibody for detection of MX1 from Human, Rat. This MX1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MX1 protein at amino acid sequence of 500-580 |
MX1 Polyclonal Antibody |
ABP59348-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human MX1 protein at amino acid sequence of 500-580
- Applications tips:
|
Description: A polyclonal antibody for detection of MX1 from Human, Rat. This MX1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MX1 protein at amino acid sequence of 500-580 |
MX1 Polyclonal Antibody |
ABP59348-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human MX1 protein at amino acid sequence of 500-580
- Applications tips:
|
Description: A polyclonal antibody for detection of MX1 from Human, Rat. This MX1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MX1 protein at amino acid sequence of 500-580 |
Anti-MX1 antibody |
STJ24650 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a guanosine triphosphate (GTP)-metabolizing protein that participates in the cellular antiviral response. The encoded protein is induced by type I and type II interferons and antagonizes the replication process of several different RNA and DNA viruses. There is a related gene located adjacent to this gene on chromosome 21, and there are multiple pseudogenes located in a cluster on chromosome 4. Alternative splicing results in multiple transcript variants. |
Anti-MX1 antibody |
STJ190368 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to MX1 |
MX1 siRNA |
20-abx925069 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MX1 siRNA |
20-abx925070 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-MX1 |
YF-PA13282 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to MX1 |
anti-MX1 |
YF-PA13283 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to MX1 |
Polyclonal MX1 + MX2 antibody |
APG02927G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MX1 + MX2 . This antibody is tested and proven to work in the following applications: |
MX1 Antibody, HRP conjugated |
1-CSB-PA015249LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against MX1. Recognizes MX1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
MX1 Antibody, FITC conjugated |
1-CSB-PA015249LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against MX1. Recognizes MX1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
MX1 Antibody, Biotin conjugated |
1-CSB-PA015249LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against MX1. Recognizes MX1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
MX1 cloning plasmid |
CSB-CL015249HU-10ug |
Cusabio |
10ug |
EUR 376 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1989
- Sequence: atggttgtttccgaagtggacatcgcaaaagctgatccagctgctgcatcccaccctctattactgaatggagatgctactgtggcccagaaaaatccaggctcggtggctgagaacaacctgtgcagccagtatgaggagaaggtgcgcccctgcatcgacctcattgactccc
- Show more
|
Description: A cloning plasmid for the MX1 gene. |
MX1 Rabbit pAb |
A1780-100ul |
Abclonal |
100 ul |
EUR 308 |
MX1 Rabbit pAb |
A1780-200ul |
Abclonal |
200 ul |
EUR 459 |
MX1 Rabbit pAb |
A1780-20ul |
Abclonal |
20 ul |
EUR 183 |
MX1 Rabbit pAb |
A1780-50ul |
Abclonal |
50 ul |
EUR 223 |
MX1 Blocking Peptide |
DF6612-BP |
Affbiotech |
1mg |
EUR 195 |
Monoclonal MX1 Antibody, Clone: 474CT4.1.5 |
APR10939G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A Monoclonal antibody against Human MX1. The antibodies are raised in Mouse and are from clone 474CT4.1.5. This antibody is applicable in WB, E |
Myxovirus Resistance 1 (MX1) Antibody |
20-abx113971 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Myxovirus Resistance 1 (MX1) Antibody |
20-abx130316 |
Abbexa |
-
EUR 481.00
-
EUR 133.00
-
EUR 1414.00
-
EUR 662.00
-
EUR 356.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Myxovirus Resistance 1 (MX1) Antibody |
20-abx001476 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Myxovirus Resistance 1 (MX1) Antibody |
abx145262-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Myxovirus Resistance 1 (MX1) Antibody |
20-abx102172 |
Abbexa |
-
EUR 453.00
-
EUR 133.00
-
EUR 1316.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Myxovirus Resistance 1 (MX1) Antibody |
20-abx102173 |
Abbexa |
-
EUR 467.00
-
EUR 133.00
-
EUR 1344.00
-
EUR 634.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Myxovirus Resistance 1 (MX1) Antibody |
20-abx102174 |
Abbexa |
-
EUR 356.00
-
EUR 926.00
-
EUR 467.00
-
EUR 154.00
-
EUR 272.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Myxovirus Resistance 1 (MX1) Antibody |
20-abx102175 |
Abbexa |
-
EUR 481.00
-
EUR 133.00
-
EUR 1414.00
-
EUR 662.00
-
EUR 356.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Myxovirus Resistance 1 (MX1) Antibody |
abx048492-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Myxovirus Resistance 1 (MX1) Antibody |
abx025431-100ul |
Abbexa |
100 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Myxovirus Resistance 1 (MX1) Antibody |
abx025432-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Myxovirus Resistance 1 (MX1) Antibody |
abx025432-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Myxovirus Resistance 1 (MX1) Antibody |
20-abx339617 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Myxovirus Resistance 1 (MX1) Antibody |
20-abx317903 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Myxovirus Resistance 1 (MX1) Antibody |
abx235450-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Porcine Interferon- induced GTP- binding protein Mx1, MX1 ELISA |
ELI-46014p |
Lifescience Market |
96 Tests |
EUR 928 |
Monoclonal MX1 Antibody (Ascites), Clone: 474CT4.1.5 |
APR11143G |
Leading Biology |
0.1 ml |
EUR 484 |
Description: A Monoclonal antibody against Human MX1 (Ascites). The antibodies are raised in Mouse and are from clone 474CT4.1.5. This antibody is applicable in WB, E |
Myxovirus Resistance 1 (MX1) Antibody Pair |
20-abx130433 |
Abbexa |
|
-
10 × 96 tests
-
5 × 96 tests
|
- Shipped within 5-12 working days.
|
Myxovirus Resistance 1 (MX1) Antibody (FITC) |
20-abx273874 |
Abbexa |
-
EUR 509.00
-
EUR 258.00
-
EUR 1539.00
-
EUR 718.00
-
EUR 411.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Myxovirus Resistance 1 (MX1) Antibody (HRP) |
20-abx314880 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Myxovirus Resistance 1 (MX1) Antibody (FITC) |
20-abx314881 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Myxovirus Resistance 1 (MX1) Antibody (Biotin) |
20-abx314882 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Myxovirus Resistance 1 (MX1) Antibody Pair |
20-abx370455 |
Abbexa |
|
-
10 × 96 tests
-
5 × 96 tests
|
- Shipped within 5-15 working days.
|
Myxovirus Resistance 1 (MX1) Antibody (FITC) |
20-abx271251 |
Abbexa |
-
EUR 523.00
-
EUR 258.00
-
EUR 1581.00
-
EUR 732.00
-
EUR 411.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Myxovirus Resistance 1 (MX1) Antibody (FITC) |
20-abx271299 |
Abbexa |
-
EUR 537.00
-
EUR 272.00
-
EUR 1664.00
-
EUR 759.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Myxovirus Resistance 1 (MX1) Antibody (Biotin) |
20-abx271517 |
Abbexa |
-
EUR 495.00
-
EUR 258.00
-
EUR 1469.00
-
EUR 690.00
-
EUR 398.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Myxovirus Resistance 1 (MX1) Antibody (Biotin) |
20-abx271565 |
Abbexa |
-
EUR 509.00
-
EUR 258.00
-
EUR 1539.00
-
EUR 718.00
-
EUR 411.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Myxovirus Resistance 1 (MX1) Antibody (Biotin) |
20-abx271864 |
Abbexa |
-
EUR 481.00
-
EUR 244.00
-
EUR 1428.00
-
EUR 676.00
-
EUR 356.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Goat Interferon induced GTP binding protein Mx1(MX1) ELISA kit |
E06I0454-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Interferon induced GTP binding protein Mx1(MX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Interferon induced GTP binding protein Mx1(MX1) ELISA kit |
E06I0454-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Interferon induced GTP binding protein Mx1(MX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Interferon induced GTP binding protein Mx1(MX1) ELISA kit |
E06I0454-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Interferon induced GTP binding protein Mx1(MX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Interferon induced GTP binding protein Mx1(MX1) ELISA kit |
E02I0454-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Interferon induced GTP binding protein Mx1(MX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Interferon induced GTP binding protein Mx1(MX1) ELISA kit |
E02I0454-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Interferon induced GTP binding protein Mx1(MX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Interferon induced GTP binding protein Mx1(MX1) ELISA kit |
E02I0454-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Interferon induced GTP binding protein Mx1(MX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Interferon induced GTP binding protein Mx1(MX1) ELISA kit |
E01I0454-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Interferon induced GTP binding protein Mx1(MX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Interferon induced GTP binding protein Mx1(MX1) ELISA kit |
E01I0454-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Interferon induced GTP binding protein Mx1(MX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Interferon induced GTP binding protein Mx1(MX1) ELISA kit |
E01I0454-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Interferon induced GTP binding protein Mx1(MX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Interferon induced GTP binding protein Mx1(MX1) ELISA kit |
E03I0454-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Interferon induced GTP binding protein Mx1(MX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Interferon induced GTP binding protein Mx1(MX1) ELISA kit |
E03I0454-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Interferon induced GTP binding protein Mx1(MX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Interferon induced GTP binding protein Mx1(MX1) ELISA kit |
E03I0454-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Interferon induced GTP binding protein Mx1(MX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Interferon induced GTP binding protein Mx1(MX1) ELISA kit |
E04I0454-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Interferon induced GTP binding protein Mx1(MX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Interferon induced GTP binding protein Mx1(MX1) ELISA kit |
E04I0454-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Interferon induced GTP binding protein Mx1(MX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Interferon induced GTP binding protein Mx1(MX1) ELISA kit |
E04I0454-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Interferon induced GTP binding protein Mx1(MX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Interferon induced GTP binding protein Mx1(MX1) ELISA kit |
E08I0454-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Interferon induced GTP binding protein Mx1(MX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Interferon induced GTP binding protein Mx1(MX1) ELISA kit |
E08I0454-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Interferon induced GTP binding protein Mx1(MX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Interferon induced GTP binding protein Mx1(MX1) ELISA kit |
E08I0454-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Interferon induced GTP binding protein Mx1(MX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Interferon induced GTP binding protein Mx1(MX1) ELISA kit |
E07I0454-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Interferon induced GTP binding protein Mx1(MX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Interferon induced GTP binding protein Mx1(MX1) ELISA kit |
E07I0454-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Interferon induced GTP binding protein Mx1(MX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Interferon induced GTP binding protein Mx1(MX1) ELISA kit |
E07I0454-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Interferon induced GTP binding protein Mx1(MX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Interferon induced GTP binding protein Mx1(MX1) ELISA kit |
E09I0454-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Interferon induced GTP binding protein Mx1(MX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Interferon induced GTP binding protein Mx1(MX1) ELISA kit |
E09I0454-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Interferon induced GTP binding protein Mx1(MX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Interferon induced GTP binding protein Mx1(MX1) ELISA kit |
E09I0454-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Interferon induced GTP binding protein Mx1(MX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Interferon-induced GTP-binding protein Mx1(MX1) ELISA kit |
CSB-EL015249HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Interferon-induced GTP-binding protein Mx1 (MX1) in samples from serum, plasma, urine, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Interferon-induced GTP-binding protein Mx1(MX1) ELISA kit |
1-CSB-EL015249HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Interferon-induced GTP-binding protein Mx1(MX1) in samples from serum, plasma, urine, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human MX1 shRNA Plasmid |
20-abx953030 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
MX1 protein (His tag) |
80R-3961 |
Fitzgerald |
100 ug |
EUR 435 |
Description: Recombinant Human MX1 protein |
Mouse MX1 shRNA Plasmid |
20-abx971631 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Guinea pig Interferon induced GTP binding protein Mx1(MX1) ELISA kit |
E05I0454-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Interferon induced GTP binding protein Mx1(MX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Interferon induced GTP binding protein Mx1(MX1) ELISA kit |
E05I0454-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Interferon induced GTP binding protein Mx1(MX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Interferon induced GTP binding protein Mx1(MX1) ELISA kit |
E05I0454-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Interferon induced GTP binding protein Mx1(MX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Myxovirus Resistance 1 (MX1) Monoclonal Antibody (Human) |
4-MAL763Hu21 |
Cloud-Clone |
-
EUR 270.00
-
EUR 2879.00
-
EUR 709.00
-
EUR 343.00
-
EUR 224.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Ser80~Leu342
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Human Myxovirus Resistance 1 (MX1) |
Myxovirus Resistance 1 (MX1) Polyclonal Antibody (Mouse) |
4-PAL763Mu01 |
Cloud-Clone |
-
EUR 266.00
-
EUR 2813.00
-
EUR 694.00
-
EUR 337.00
-
EUR 222.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MX1 (Gly43~Leu308)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Myxovirus Resistance 1 (MX1) |
Myxovirus Resistance 1 (MX1) Polyclonal Antibody (Rat) |
4-PAL763Ra01 |
Cloud-Clone |
-
EUR 275.00
-
EUR 2958.00
-
EUR 727.00
-
EUR 350.00
-
EUR 226.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MX1 (Asn400~Asn652)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Myxovirus Resistance 1 (MX1) |
Myxovirus Resistance 1 (MX1) Polyclonal Antibody (Rat) |
4-PAL763Ra02 |
Cloud-Clone |
-
EUR 275.00
-
EUR 2958.00
-
EUR 727.00
-
EUR 350.00
-
EUR 226.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MX1 (Gly68~Leu303) linked with LEHHHHHH
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Myxovirus Resistance 1 (MX1) |
Active Myxovirus Resistance 1 (MX1) |
4-APL763Hu01 |
Cloud-Clone |
-
EUR 680.61
-
EUR 285.00
-
EUR 2277.28
-
EUR 825.76
-
EUR 1551.52
-
EUR 518.00
-
EUR 5543.20
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P20591
- Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 30.3kDa
- Isoelectric Point: 5.8
|
Description: Recombinant Human Myxovirus Resistance 1 expressed in: Available from E.coli, Yeast, Baculovirus and Mammalian cells |
Myxovirus Resistance 1 (MX1) Protein |
20-abx261148 |
Abbexa |
-
EUR 3418.00
-
EUR 328.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
MX1 ORF Vector (Human) (pORF) |
ORF006808 |
ABM |
1.0 ug DNA |
EUR 95 |
Mx1 ORF Vector (Mouse) (pORF) |
ORF050804 |
ABM |
1.0 ug DNA |
EUR 95 |
Mx1 ORF Vector (Rat) (pORF) |
ORF070945 |
ABM |
1.0 ug DNA |
EUR 506 |
Recombinant Myxovirus Resistance 1 (MX1) |
4-RPL763Hu01 |
Cloud-Clone |
-
EUR 422.56
-
EUR 216.00
-
EUR 1309.60
-
EUR 503.20
-
EUR 906.40
-
EUR 346.00
-
EUR 3124.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P20591
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 30.6kDa
- Isoelectric Point: 5.8
|
Description: Recombinant Human Myxovirus Resistance 1 expressed in: E.coli |
Recombinant Myxovirus Resistance 1 (MX1) |
4-RPL763Mu01 |
Cloud-Clone |
-
EUR 494.24
-
EUR 235.00
-
EUR 1578.40
-
EUR 592.80
-
EUR 1085.60
-
EUR 394.00
-
EUR 3796.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P09922
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 56.1kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Mouse Myxovirus Resistance 1 expressed in: E.coli |
Recombinant Myxovirus Resistance 1 (MX1) |
4-RPL763Ra01 |
Cloud-Clone |
-
EUR 503.20
-
EUR 238.00
-
EUR 1612.00
-
EUR 604.00
-
EUR 1108.00
-
EUR 400.00
-
EUR 3880.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P18588
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 57.1kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Rat Myxovirus Resistance 1 expressed in: E.coli |
Recombinant Myxovirus Resistance 1 (MX1) |
4-RPL763Ra02 |
Cloud-Clone |
-
EUR 519.33
-
EUR 242.00
-
EUR 1672.48
-
EUR 624.16
-
EUR 1148.32
-
EUR 410.00
-
EUR 4031.20
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P18588
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 29.9kDa
- Isoelectric Point: 6.6
|
Description: Recombinant Rat Myxovirus Resistance 1 expressed in: E.coli |
MX1 ELISA Kit (Human) (OKCD00718) |
OKCD00718 |
Aviva Systems Biology |
96 Wells |
EUR 909 |
Description: Description of target: Interferon-induced dynamin-like GTPase with antiviral activity against a wide range of RNA viruses and some DNA viruses. Its target viruses include negative-stranded RNA viruses and HBV through binding and inactivation of their ribonucleocapsid. May also antagonize reoviridae and asfarviridae replication. Inhibits thogoto virus (THOV) replication by preventing the nuclear import of viral nucleocapsids. Inhibits La Crosse virus (LACV) replication by sequestering viral nucleoprotein in perinuclear complexes, preventing genome amplification, budding, and egress. Inhibits influenza A virus (IAV) replication by decreasing or delaying NP synthesis and by blocking endocytic traffic of incoming virus particles. Enhances ER stress-mediated cell death after influenza virus infection. May regulate the calcium channel activity of TRPCs.13 Publications
<p>Manually curated information for which there is published experimental evidence.</p>
<p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.17"Antivirally active MxA protein sequesters La Crosse virus nucleocapsid protein into perinuclear complexes."_x005F_x005F_x000D_Kochs G., Janzen C., Hohenberg H., Haller O._x005F_x005F_x000D_Proc. Natl. Acad. Sci. U.S.A. 99:3153-3158(2002) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, SUBCELLULAR LOCATION, INTERACTION WITH LACV PROTEIN N, MUTAGENESIS OF GLU-645.Ref.18"Human MxA protein inhibits the replication of Crimean-Congo hemorrhagic fever virus."_x005F_x005F_x000D_Andersson I., Bladh L., Mousavi-Jazi M., Magnusson K.E., Lundkvist A., Haller O., Mirazimi A._x005F_x005F_x000D_J. Virol. 78:4323-4329(2004) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, SUBCELLULAR LOCATION, INTERACTION WITH CCHFV PROTEIN N, MUTAGENESIS OF GLU-645.Ref.19"Nuclear MxA proteins form a complex with influenza virus NP and inhibit the transcription of the engineered influenza virus genome."_x005F_x005F_x000D_Turan K., Mibayashi M., Sugiyama K., Saito S., Numajiri A., Nagata K._x005F_x005F_x000D_Nucleic Acids Res. 32:643-652(2004) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION.Ref.20"Missorting of LaCrosse virus nucleocapsid protein by the interferon-induced MxA GTPase involves smooth ER membranes."_x005F_x005F_x000D_Reichelt M., Stertz S., Krijnse-Locker J., Haller O., Kochs G._x005F_x005F_x000D_Traffic 5:772-784(2004) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, SUBCELLULAR LOCATION.Ref.21"Inhibition of Dugbe nairovirus replication by human MxA protein."_x005F_x005F_x000D_Bridgen A., Dalrymple D.A., Weber F., Elliott R.M._x005F_x005F_x000D_Virus Res. 99:47-50(2004) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION.Ref.22"MxA, a member of the dynamin superfamily, interacts with the ankyrin-like repeat domain of TRPC."_x005F_x005F_x000D_Lussier M.P., Cayouette S., Lepage P.K., Bernier C.L., Francoeur N., St-Hilaire M., Pinard M., Boulay G._x005F_x005F_x000D_J. Biol. Chem. 280:19393-19400(2005) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, INTERACTION WITH TRPC1; TRPC3; TRPC4; TRPC5; TRPC6 AND TRPC7, MUTAGENESIS OF LYS-83; THR-103 AND LEU-612.Ref.23"Assay and functional analysis of dynamin-like Mx proteins."_x005F_x005F_x000D_Kochs G., Reichelt M., Danino D., Hinshaw J.E., Haller O._x005F_x005F_x000D_Methods Enzymol. 404:632-643(2005) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, SUBCELLULAR LOCATION, OLIGOMERIZATION, INTERACTION WITH LACV PROTEIN N.Ref.26"Expression of the interferon-alpha/beta-inducible bovine Mx1 dynamin interferes with replication of rabies virus."_x005F_x005F_x000D_Leroy M., Pire G., Baise E., Desmecht D._x005F_x005F_x000D_Neurobiol. Dis. 21:515-521(2006) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION.Ref.27"Human MxA protein confers resistance to double-stranded RNA viruses of two virus families."_x005F_x005F_x000D_Mundt E._x005F_x005F_x000D_J. Gen. Virol. 88:1319-1323(2007) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION.Ref.29"GTPase activity is not essential for the interferon-inducible MxA protein to inhibit the replication of hepatitis B virus."_x005F_x005F_x000D_Yu Z., Wang Z., Chen J., Li H., Lin Z., Zhang F., Zhou Y., Hou J._x005F_x005F_x000D_Arch. Virol. 153:1677-1684(2008) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION.Ref.30"Inhibition of a large double-stranded DNA virus by MxA protein."_x005F_x005F_x000D_Netherton C.L., Simpson J., Haller O., Wileman T.E., Takamatsu H.H., Monaghan P., Taylor G._x005F_x005F_x000D_J. Virol. 83:2310-2320(2009) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, SUBCELLULAR LOCATION.Ref.34"Stalk domain of the dynamin-like MxA GTPase protein mediates membrane binding and liposome tubulation via the unstructured L4 loop."_x005F_x005F_x000D_von der Malsburg A., Abutbul-Ionita I., Haller O., Kochs G., Danino D._x005F_x005F_x000D_J. Biol. Chem. 286:37858-37865(2011) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, SUBUNIT, SUBCELLULAR LOCATION, MUTAGENESIS OF LYS-554; LYS-555; LYS-556 AND LYS-557.Ref.36"Interferon-inducible antiviral protein MxA enhances cell death triggered by endoplasmic reticulum stress."_x005F_x005F_x000D_Numajiri Haruki A., Naito T., Nishie T., Saito S., Nagata K._x005F_x005F_x000D_J. Interferon Cytokine Res. 31:847-856(2011) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, SUBCELLULAR LOCATION, INTERACTION WITH HSPA5. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.64 ng/mL |
MX1 ELISA Kit (Human) (OKAN06502) |
OKAN06502 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: This gene encodes a guanosine triphosphate (GTP)-metabolizing protein that participates in the cellular antiviral response. The encoded protein is induced by type I and type II interferons and antagonizes the replication process of several different RNA and DNA viruses. There is a related gene located adjacent to this gene on chromosome 21, and there are multiple pseudogenes located in a cluster on chromosome 4. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.65 ng/mL |
MX1 ELISA Kit (Rat) (OKCD09322) |
OKCD09322 |
Aviva Systems Biology |
96 Wells |
EUR 1157 |
Description: Description of target: Interferon-induced dynamin-like GTPase which has antiviral activity against influenza A virus, (IAV) and Thogoto virus (THOV). Inhibits IAV by interefering with the process of primary transcription, probably by affecting the viral polymerase function. ;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 0.119ng/mL |
MX1 ELISA Kit (Human) (OKCA00704) |
OKCA00704 |
Aviva Systems Biology |
96 Wells |
EUR 909 |
Description: Description of target: This gene encodes a guanosine triphosphate (GTP)-metabolizing protein that participates in the cellular antiviral response. The encoded protein is induced by type I and type II interferons and antagonizes the replication process of several different RNA and DNA viruses. There is a related gene located adjacent to this gene on chromosome 21, and there are multiple pseudogenes located in a cluster on chromosome 4. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 3.9 pg/mL |
MX1 ELISA Kit (Bovine) (OKCA01033) |
OKCA01033 |
Aviva Systems Biology |
96 Wells |
EUR 930 |
Description: Description of target: Interferon-induced dynamin-like GTPase with antiviral activity against rabies virus (RABV), vesicular stomatitis virus (VSV) and murine pneumonia virus (MPV). Isoform 1 but not isoform 2 shows antiviral activity against vesicular stomatitis virus (VSV).;Species reactivity: Bovine;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 7 pg/mL |
Myxovirus Resistance 1 (MX1) Monoclonal Antibody (Human), APC |
4-MAL763Hu21-APC |
Cloud-Clone |
-
EUR 380.00
-
EUR 3779.00
-
EUR 1038.00
-
EUR 490.00
-
EUR 234.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Ser80~Leu342
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Human Myxovirus Resistance 1 (MX1). This antibody is labeled with APC. |
Myxovirus Resistance 1 (MX1) Monoclonal Antibody (Human), Biotinylated |
4-MAL763Hu21-Biotin |
Cloud-Clone |
-
EUR 337.00
-
EUR 2829.00
-
EUR 819.00
-
EUR 417.00
-
EUR 230.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Ser80~Leu342
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Human Myxovirus Resistance 1 (MX1). This antibody is labeled with Biotin. |
Myxovirus Resistance 1 (MX1) Monoclonal Antibody (Human), Cy3 |
4-MAL763Hu21-Cy3 |
Cloud-Clone |
-
EUR 465.00
-
EUR 4997.00
-
EUR 1343.00
-
EUR 612.00
-
EUR 271.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Ser80~Leu342
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Human Myxovirus Resistance 1 (MX1). This antibody is labeled with Cy3. |
Myxovirus Resistance 1 (MX1) Monoclonal Antibody (Human), FITC |
4-MAL763Hu21-FITC |
Cloud-Clone |
-
EUR 324.00
-
EUR 3043.00
-
EUR 850.00
-
EUR 412.00
-
EUR 207.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Ser80~Leu342
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Human Myxovirus Resistance 1 (MX1). This antibody is labeled with FITC. |
Myxovirus Resistance 1 (MX1) Monoclonal Antibody (Human), HRP |
4-MAL763Hu21-HRP |
Cloud-Clone |
-
EUR 346.00
-
EUR 3291.00
-
EUR 916.00
-
EUR 441.00
-
EUR 220.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Ser80~Leu342
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Human Myxovirus Resistance 1 (MX1). This antibody is labeled with HRP. |
Myxovirus Resistance 1 (MX1) Monoclonal Antibody (Human), PE |
4-MAL763Hu21-PE |
Cloud-Clone |
-
EUR 324.00
-
EUR 3043.00
-
EUR 850.00
-
EUR 412.00
-
EUR 207.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Ser80~Leu342
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Human Myxovirus Resistance 1 (MX1). This antibody is labeled with PE. |
Myxovirus Resistance 1 (MX1) Polyclonal Antibody (Human, Mouse) |
4-PAL763Hu01 |
Cloud-Clone |
-
EUR 262.00
-
EUR 2747.00
-
EUR 679.00
-
EUR 331.00
-
EUR 220.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MX1 (Ser80~Leu342)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Myxovirus Resistance 1 (MX1) |
Myxovirus Resistance 1 (MX1) Polyclonal Antibody (Mouse), APC |
4-PAL763Mu01-APC |
Cloud-Clone |
-
EUR 374.00
-
EUR 3689.00
-
EUR 1016.00
-
EUR 481.00
-
EUR 232.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MX1 (Gly43~Leu308)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Myxovirus Resistance 1 (MX1). This antibody is labeled with APC. |
Myxovirus Resistance 1 (MX1) Polyclonal Antibody (Mouse), Biotinylated |
4-PAL763Mu01-Biotin |
Cloud-Clone |
-
EUR 332.00
-
EUR 2763.00
-
EUR 803.00
-
EUR 411.00
-
EUR 228.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MX1 (Gly43~Leu308)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Myxovirus Resistance 1 (MX1). This antibody is labeled with Biotin. |
Myxovirus Resistance 1 (MX1) Polyclonal Antibody (Mouse), Cy3 |
4-PAL763Mu01-Cy3 |
Cloud-Clone |
-
EUR 457.00
-
EUR 4877.00
-
EUR 1313.00
-
EUR 600.00
-
EUR 267.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MX1 (Gly43~Leu308)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Myxovirus Resistance 1 (MX1). This antibody is labeled with Cy3. |
Myxovirus Resistance 1 (MX1) Polyclonal Antibody (Mouse), FITC |
4-PAL763Mu01-FITC |
Cloud-Clone |
-
EUR 319.00
-
EUR 2971.00
-
EUR 832.00
-
EUR 405.00
-
EUR 205.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MX1 (Gly43~Leu308)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Myxovirus Resistance 1 (MX1). This antibody is labeled with FITC. |
Myxovirus Resistance 1 (MX1) Polyclonal Antibody (Mouse), HRP |
4-PAL763Mu01-HRP |
Cloud-Clone |
-
EUR 341.00
-
EUR 3213.00
-
EUR 897.00
-
EUR 433.00
-
EUR 217.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MX1 (Gly43~Leu308)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Myxovirus Resistance 1 (MX1). This antibody is labeled with HRP. |
Myxovirus Resistance 1 (MX1) Polyclonal Antibody (Mouse), PE |
4-PAL763Mu01-PE |
Cloud-Clone |
-
EUR 319.00
-
EUR 2971.00
-
EUR 832.00
-
EUR 405.00
-
EUR 205.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MX1 (Gly43~Leu308)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Myxovirus Resistance 1 (MX1). This antibody is labeled with PE. |
Myxovirus Resistance 1 (MX1) Polyclonal Antibody (Rat), APC |
4-PAL763Ra01-APC |
Cloud-Clone |
-
EUR 388.00
-
EUR 3887.00
-
EUR 1065.00
-
EUR 501.00
-
EUR 237.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MX1 (Asn400~Asn652)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Myxovirus Resistance 1 (MX1). This antibody is labeled with APC. |
Myxovirus Resistance 1 (MX1) Polyclonal Antibody (Rat), Biotinylated |
4-PAL763Ra01-Biotin |
Cloud-Clone |
-
EUR 343.00
-
EUR 2908.00
-
EUR 839.00
-
EUR 425.00
-
EUR 232.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MX1 (Asn400~Asn652)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Myxovirus Resistance 1 (MX1). This antibody is labeled with Biotin. |
We attributed human resistomes to totally different livestock reservoirs utilizing Random Forests, which allowed figuring out pigs as a possible supply of AMR in people. This examine thus demonstrates that it’s doable to use metagenomics in AMR source-attribution.